Piltdown

                  The Piltdown hoax happened in the early 1900s and had fooled many scientists for over 40 years. In 1912 in Luis, by the village of Piltdown Charles Dawson had been digging in a gravel pit. He had claimed to have found a piece of a human skull. Dawson had asked three other scientists to join him with his future searches in finding more fossils. Soon after a jaw bone was found although it was nothing of what anyone had ever seen before. The jaw line had an ape structure yet the teeth were example of human teeth because they were flat. This was an extreme find at that time because no fossils had ever been found in Europe before. The hoax was discovered by a full scale analysis that was launched in 1953. They discovered that there were scratches on the teeth giving them evidence that the teeth had actually been filed down. The jawbone was less than 100 years old and it was from a female orangutan giving them evidence that someone had actually forged the fossils. The forgery of these fossils cause scientists to believe that there were earlier findings that they had not yet found before.

                In this situation any scientist can get ahead of themselves in trying to be the best. Yes they are only human but when it comes to being the best, most humans try there hardest no matter what. Just in this situation, of whoever faked the fossil, tried to prove something to be the best and he turned out to be fraud. Faults like this effect the scientific process in multiple ways starting from the results. If people keep attempting to fake all of these fossils imagine the devastation in multiple situations.

                A scientist named Kenneth Oakley had ran a test called a fluorine test. The fluorine would accumulate calcium that would contain organic matter like bones and teeth. But what Oakley had discovered from this test was that the fossils had to of been less than 50,000 years old. From what they had claimed that this was from an ape like specie, that is definitely not true because it was not even old enough to be qualified as an ape like species. Two more scientists names Joseph Weiner and Wilfred Le Gros Clark had teamed up to further along the investigation to prove that the fossils were not what they had been said to be. The two fossils had been proved that they were actually 2 separate species not even of the same kind. The part of a skull was from a human and then the jaw was from an ape. The scratched proved the teeth were filed down in order to make them look like a humans. Other findings that Dawson had claimed to have been found were also proven to be artificially stained in which made to match the local gravels.

                In certain situations I believe it is possible to remove the human factor just to make it so certain situations like these do not happen. Although most of the time humans are how we find out certiana aspects of life. So that would be one hard thing to change. Never take anything or judge a book by a cover. Mainly because you can’t always prove everything just by looking at the cover. That is one thing that I learned from this scandal.

Comparative Primate

Add caption

Lemurs are known as the “before monkeys” in which they are native to the island of Madagascar.  As well as the neighboring Comoro islands. The diet of them in the wild includes fruits, leaves and other edible plant materials. Lemurs live in the tops of trees, which is a direct representation to their diet.  They are either at the top of a tree or at mid level in the middle of the forest. Although Lemurs are not usually awake during the day they are normally awake during the night. A type of Lemur called an Aye-Aye was able to use their middle finger which is claw like in order to dig insects out of the bark of a tree. This trait could have been evolved over time to allow the lemurs to eat at high levels without having difficulty. The claw is called a “toilet claw” which is extended. The claw allows them to get there specified diet when traveling from tree to tree.

Spider Monkeys live in South and North America in the tropical rain forests. They spend most of their time aloft with their long, lanky arms and gripping tails. The spider Monkeys travel in groups of two to three dozen. Although during the night they split p into separate groups. They are omnivorous, categorized as fruigivorous do to their fruit and seed based diets. They almost rarely feed on animal prey. Because of their eating habits, when they are in large groups it is not always a good thing because there food source is seasonal and very limited. The spider monkeys have two adaptations that allows them to eat the way they do and travel the way they do.  There thumb has adapted to their environment, which is a shrunken thumb. There thumb has become shrunken because it is not needed. Although their tails have developed a patch of skin with lines on it that enables a stronger grip when attached to trees that can also easily grip there food.

Baboons are from Africa or Arabia and range from 32 pounds to 88 pounds. They prefer savanna and semi-arid habitats although some live in tropical rain forests. Unlike other monkeys, baboons do not have gripping tails but they are still able to climb trees in order to eat sleep and do other things. They eat a lot of crops like fruit, grass, seeds, bark, roots, and they also occasionally eat meat. Meats such as birds, rodents, young of larger mammals and other animals. Traveling in large groups allows them to track their prey more easier and capture their prey. Large groups travel during the day and seek out there meals and smaller groups travel during the day to do the same. Baboons spend most of their time on the group which allows them track there pray and find their crops at a much easier rate.

Gibbons are from the dense forests of South Asia. They are adapted to life in the trees and rarely come down to the ground. They have long arms, used in arm swinging called brachiating. Hands and fingers are also very long. They have a short thumb, and their fingers are in the formation of a hook that is used during brachiating. Brachiating allows them to move at fast speeds throughout the forest. They feed on fruits which brachiating limits competition because they are able to grab fruits from the end of the branches. Gibbons are fond on figs but mainly favor on fruits in trees. There life in the trees allows them easy access to their appetite. Adapting over time hooks for fingers allows easy grabbing.

Chimpanzees local habitats are in African rain forests, woodlands, and grasslands. They are very versatile in which they can swing through the trees or walk on all fours on the ground. Although most of their food source comes from the trees. They are able to swing from tree to tree capturing there food. They eat fruits, plants, and sometimes eat insects, eggs and meat. The chimpanzees have a large range of a diet. They use resources from there environment to access their food such as using sticks to get insects from out of the ground or out of trees. Stones are used to crack open nuts or squash fruit that they eat. Chimpanzees adapt to their environment by what they eat due to the fact that what they eat  is consumed from environmental tools.

http://www.lemurs.us/basics.html

http://animals.nationalgeographic.com/animals/mammals/spider-monkey/

http://www.macalester.edu/~montgomery/spidermonkey.html

http://animals.nationalgeographic.com/animals/mammals/baboon/

http://animals.nationalgeographic.com/animals/mammals/gibbon/

http://animals.nationalgeographic.com/animals/mammals/chimpanzee/

Summary: Between all of the animals, they all seemed to vary in the same situations. Although they all had there own different ways of capturing there pray or food. For instance the monkey using there tails with grip to hang or there arms to travel at fast speeds. Each and every one had something that related them to the environment and allowed them to survive. Some traveled in large groups in order to protect themselves, they did what they had to do in order to survive. Some of the time it was not always good because some would gain food more than other but they did what they had to do in order to survive. The environment had a huge impact on a lot of there survival. The animals adapted there arms, legs, hands, and tails to there certain surroundings.

Analogy/Homology

1.

A.      A lizard and a bird. The both came from an common ancestor.

B.      The first tetrapod, had limbs with one long bone (the humorous) attached to two other long bones (the radius and ulna). Both of them inherited the tetrapod limb. A lizard’s tetrapod limb is used to help with walking or running. Its bones are much shorter then a birds bones. A birds tetrapod limb helps it fly. It is used in the bird’s wings which has much longer bones than that of a lizard. The differences between the two species evolved over time to adapt to their environments to survive. Although they all kept the same type of bone structure.

C.      The common ancestor was known as the tetrapod which was actually the first tetrapod. The ancestor had this trait in its legs and arms, although the trait may not look the same due to it being my shorter and much thicker, was a direct relation to them.

D.

2.

A.  Butterflies and Birds

B. In both of these they had wings. In which they both experience multiple differences and similarities. The wings of butterflies have scales while the wings of birds have feathers. They both adapted to life in the air so they evolved wings.

C.  Birds com from the ancestor of dinosaurs. It is said to be a maniraptoran in which did not have wings. The common ancestor of a butterfly is said to be the moth. Relating to the butterfly mainly because it did fly and it did have wings.

D.

DNA

TACACTGAATATAAGTTGAATCACGGGAACGCAATC